gene synthesis with sub- cloning service Search Results


99
Qiagen qiamo fast dna stool kit
KEY RESOURCES TABLE
Qiamo Fast Dna Stool Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gene+synthesis+with+sub-+cloning+service/pmc09032671-63-0-6?v=Qiagen
Average 99 stars, based on 1 article reviews
qiamo fast dna stool kit - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
Thermo Fisher phusion dna polymerase
KEY RESOURCES TABLE
Phusion Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gene+synthesis+with+sub-+cloning+service/pmc03877817-336-23-27?v=Thermo+Fisher
Average 99 stars, based on 1 article reviews
phusion dna polymerase - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
New England Biolabs vector pet28b
KEY RESOURCES TABLE
Vector Pet28b, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gene+synthesis+with+sub-+cloning+service/pmc09303356__CBIC___23___0___s001-65-6-15?v=New+England+Biolabs
Average 99 stars, based on 1 article reviews
vector pet28b - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
New England Biolabs nebuilder hifi dna assembly kit
KEY RESOURCES TABLE
Nebuilder Hifi Dna Assembly Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gene+synthesis+with+sub-+cloning+service/pm33398158__41477_2020_827_MOESM1_ESM-3-24-24?v=New+England+Biolabs
Average 99 stars, based on 1 article reviews
nebuilder hifi dna assembly kit - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

90
Promega pgem-t easy
KEY RESOURCES TABLE
Pgem T Easy, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gene+synthesis+with+sub-+cloning+service/pm37958738-213-13-17?v=Promega
Average 90 stars, based on 1 article reviews
pgem-t easy - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

99
New England Biolabs nebuilder hifi dna assembly master mix
KEY RESOURCES TABLE
Nebuilder Hifi Dna Assembly Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gene+synthesis+with+sub-+cloning+service/bio_rxiv__2025__10__01__679865-177-9-16?v=New+England+Biolabs
Average 99 stars, based on 1 article reviews
nebuilder hifi dna assembly master mix - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

94
Toyobo thermococcus kodakaraensis dna polymerase
Fig. 3. The length distribution of the 3’-5’ junction of (A) circular soc RNA or (B) ligated uvsY RNA-16S rRNA. After reverse tran- scription of total RNA from T4-infected cells, cDNA was utilized for amplification by PCR as described in Materials and Methods. After amplified DNAs were electrophoresed through a 5% polyacrylamide gel, <t>DNA</t> fragments in a size range of 210– 280 bp for soc and of 250–320 bp for uvsY were eluted from gel, heat-denatured and utilized for the length analysis. The length analysis was performed as follows. The csoc-up primer for soc or 16S5’ primer for uvsY was labeled at its 5’-end with 32P using T4 polynucle- otide kinase, annealed to heat-denatured DNA and subjected to chain-elongation by Taq DNA <t>polymerase</t> at 72°C for 160 sec. The chain-elongation reaction was carried out in a mixture contained 50 mM Tris-HCl (pH 8.3), 3 mM MgCl2, 250 µg/ml bovine serum albu- min, 2% sucrose and 0.2 mM each of four deoxyribonucleotides. The products were heat-denatured and analyzed through a 5%-poly- acrylamide gel containing 6 M urea (lanes 1 and 3). Preparation of reference strands was as follows: pCSOC#5 or pY-EC16#4 DNA was used as a template for PCR with a respective set of primers (csoc-dw and csoc-up for soc, and uvsY3’ and 16S5’ for uvsY). The amplified fragments were heat-denatured and used as a template for strand elongation in the same manner as above. The reference strands were run in parallel (lanes 2 and 4). Sequence ladders obtained by dideoxynucleotide method (Innis et al., 1988) with either a combination of pCSOC#5 and csoc-up primer or a combination of pY-EC16#4 and 16S5’ primer were also run in each left four lanes (G, A, T, C) of figure A or B, respectively. In the left margins, sequences at the border of cloned DNA and vector are shown.
Thermococcus Kodakaraensis Dna Polymerase, supplied by Toyobo, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gene+synthesis+with+sub-+cloning+service/pm12419894-48-7-13?v=Toyobo
Average 94 stars, based on 1 article reviews
thermococcus kodakaraensis dna polymerase - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

90
OriGene mouse slx4
<t>SLX1/SLX4</t> contribute to fragile telomere formation in Blm-deficient cells. (A) Western blot analysis of BLM in BlmF/F MEFs ± Cre (96 h). γ-Tubulin serves as the loading control. (B) Telomere FISH on metaphase spreads of BlmF/F MEFs ± Cre (96 h) with Cy3-[CCCTAA]3 probes (green) and DAPI staining (red). Fragile telomeres are marked by an asterisk. (C) Knockdown of ZRANB3, SMARCAL1, and HTLF with shRNAs (6 d) in BlmF/F MEFs verified by Western blotting. Cells infected with an shRNA targeting Luciferase (shLuc) were used as the control. γ-Tubulin serves as the loading control and an asterisk marks a nonspecific band detected by the HLTF antibody. (D) Quantification of fragile telomeres detected by FISH (q arms only) in BlmF/F MEFs ± Cre (96 h) with shRNAs targeting Luc, ZRANB3, SMARCAL1, or HTLF as described in C. (E) Quantification of q arm fragile telomeres detected by FISH in BlmF/F MEFs ± Cre (96 h) after CRISPR/Cas9 targeting of Slx4 with three different sgRNAs. Control cells were infected with an sgRNA targeting Luciferase (sgLuc). The relative level of SLX4 mRNA normalized to GAPDH was determined by RT-qPCR and compared with the sgLuc sample (set to 100). (F) Western blot analysis of SLX1 after CRISPR/Cas9 targeting of Slx1 with three different sgRNAs. γ-Tubulin serves as the loading control. (G) Quantification of q arm fragile telomeres detected by FISH in BlmF/F MEFs ± Cre (96 h) after CRISPR/Cas9 targeting of Slx1 with three different sgRNAs as in F. (H) Western blot analysis of the expression of FLAG-SLX4 and various mutants in BlmF/F MEFs with γ-Tubulin as the loading control. (I) Quantification of q arm fragile telomeres detected by FISH in BlmF/F MEFs + Cre (96 h) expressing empty vector (−), sgRNA-resistant WT FLAG-SLX4 or various mutants with CRISPR/Cas9 targeting of Luc or Slx4. (J) PLA foci (red) of TRF1 and γH2AX detected in BlmF/F MEFs ± Cre (96 h). (K) Quantification of PLA foci as in J in BlmF/F MEFs ± Cre (96 h) with CRISPR/Cas9 targeting of Luc, Slx4, or Slx1. Data are means ± SD of four independent experiments of >100 nuclei each. P-values were from paired two-tailed t-tests. (*) P ≤ 0.05. (L) PLA foci (red) of FLAG-TRF1 and 53BP1 detected in BlmF/F MEFs ± Cre (96 h). (M) Quantification of FLAG-TRF1/53BP1 PLA foci in BlmF/F MEFs ± Cre (96 h) with CRISPR/Cas9 targeting of Luc, Slx4, or Slx1. Data are means ± SD of three independent experiments of >100 nuclei each. For the fragile telomere analyses in D, E, G, and I, data are means ± SD from three independent experiments with ∼2000 telomeres analyzed per experiment. All P-values except for the ones in K were derived from unpaired two-tailed t-tests. (***) P ≤ 0.001, (**) P ≤ 0.01, (*) P ≤ 0.05, (n.s.) P > 0.05.
Mouse Slx4, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gene+synthesis+with+sub-+cloning+service/pmc07528700-359-0-8?v=OriGene
Average 90 stars, based on 1 article reviews
mouse slx4 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

94
Genecopoeia human lnc rab11b as1
Primers used in this study
Human Lnc Rab11b As1, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gene+synthesis+with+sub-+cloning+service/pmc07290536-279-12-33?v=Genecopoeia
Average 94 stars, based on 1 article reviews
human lnc rab11b as1 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

96
Addgene inc plko 1 trc cloning vector
Primers used in this study
Plko 1 Trc Cloning Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gene+synthesis+with+sub-+cloning+service/pmc07556057-33-18-21?v=Addgene+inc
Average 96 stars, based on 1 article reviews
plko 1 trc cloning vector - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

86
Twist Bioscience genetic plasmid phw2000
Primers used in this study
Genetic Plasmid Phw2000, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gene+synthesis+with+sub-+cloning+service/pm41317858-233-44-48?v=Twist+Bioscience
Average 86 stars, based on 1 article reviews
genetic plasmid phw2000 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

99
ATCC human lung adenocarcinoma cell lines a549
Expression of the TdIF1 gene in lung cancer. a The RNA-Seq data of 57 pairs of cancer and adjacent nontumor tissues from lung cancer patients were obtained from the TCGA common database and analyzed by Cuffdiff2. The fold changes in TdIF1 expression in lung cancer tissue vs noncancerous adjacent tissue were calculated and displayed. b Kaplan–Meier analysis of overall survival of patients with expression of TdIF1 in 82 lung <t>adenocarcinoma</t> patients (* P = 0.037). c H&E and immunohistochemical staining to detect TdIF1 expression in lung cancer and noncancer adjacent tissue. d Transcript abundance of TdIF1 in lung cancer cell lines. Expression of TdIF1 in 3 lung cancer cell lines. The three indicated lung cancer cell lines were cultured, and mRNA was collected. The expression of TdIF1 was determined by quantitative PCR. The abundance of TdIF1 expression was calculated in comparison to the internal control housekeeping gene, GAPDH. e Expression of TdIF1 in normal lung cell lines. Total protein (40 μg) was extracted from the normal human lung cell line BEAS-2B (bronchial epithelial cells) and the lung cancer cell line <t>A549.</t> Samples were subjected to western blotting using antibodies against TdIF1 and GAPDH. The data show one of three representative experiments. Error bars represent the standard deviation of three experiments
Human Lung Adenocarcinoma Cell Lines A549, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gene+synthesis+with+sub-+cloning+service/pmc06194072-65-1-24?v=ATCC
Average 99 stars, based on 1 article reviews
human lung adenocarcinoma cell lines a549 - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

Image Search Results


KEY RESOURCES TABLE

Journal: Cell reports

Article Title: Btla signaling in conventional and regulatory lymphocytes coordinately tempers humoral immunity in the intestinal mucosa

doi: 10.1016/j.celrep.2022.110553

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: QIAmo Fast DNA Stool kit , Qiagen , 51604.

Techniques: Control, Plasmid Preparation, Recombinant, Cell Isolation, cDNA Synthesis, SYBR Green Assay, Staining, Enzyme-linked Immunosorbent Assay, Cloning, Library Quantification, Software

Fig. 3. The length distribution of the 3’-5’ junction of (A) circular soc RNA or (B) ligated uvsY RNA-16S rRNA. After reverse tran- scription of total RNA from T4-infected cells, cDNA was utilized for amplification by PCR as described in Materials and Methods. After amplified DNAs were electrophoresed through a 5% polyacrylamide gel, DNA fragments in a size range of 210– 280 bp for soc and of 250–320 bp for uvsY were eluted from gel, heat-denatured and utilized for the length analysis. The length analysis was performed as follows. The csoc-up primer for soc or 16S5’ primer for uvsY was labeled at its 5’-end with 32P using T4 polynucle- otide kinase, annealed to heat-denatured DNA and subjected to chain-elongation by Taq DNA polymerase at 72°C for 160 sec. The chain-elongation reaction was carried out in a mixture contained 50 mM Tris-HCl (pH 8.3), 3 mM MgCl2, 250 µg/ml bovine serum albu- min, 2% sucrose and 0.2 mM each of four deoxyribonucleotides. The products were heat-denatured and analyzed through a 5%-poly- acrylamide gel containing 6 M urea (lanes 1 and 3). Preparation of reference strands was as follows: pCSOC#5 or pY-EC16#4 DNA was used as a template for PCR with a respective set of primers (csoc-dw and csoc-up for soc, and uvsY3’ and 16S5’ for uvsY). The amplified fragments were heat-denatured and used as a template for strand elongation in the same manner as above. The reference strands were run in parallel (lanes 2 and 4). Sequence ladders obtained by dideoxynucleotide method (Innis et al., 1988) with either a combination of pCSOC#5 and csoc-up primer or a combination of pY-EC16#4 and 16S5’ primer were also run in each left four lanes (G, A, T, C) of figure A or B, respectively. In the left margins, sequences at the border of cloned DNA and vector are shown.

Journal: Genes & genetic systems

Article Title: Scarce adenylation in bacteriophage T4 mRNAs.

doi: 10.1266/ggs.77.219

Figure Lengend Snippet: Fig. 3. The length distribution of the 3’-5’ junction of (A) circular soc RNA or (B) ligated uvsY RNA-16S rRNA. After reverse tran- scription of total RNA from T4-infected cells, cDNA was utilized for amplification by PCR as described in Materials and Methods. After amplified DNAs were electrophoresed through a 5% polyacrylamide gel, DNA fragments in a size range of 210– 280 bp for soc and of 250–320 bp for uvsY were eluted from gel, heat-denatured and utilized for the length analysis. The length analysis was performed as follows. The csoc-up primer for soc or 16S5’ primer for uvsY was labeled at its 5’-end with 32P using T4 polynucle- otide kinase, annealed to heat-denatured DNA and subjected to chain-elongation by Taq DNA polymerase at 72°C for 160 sec. The chain-elongation reaction was carried out in a mixture contained 50 mM Tris-HCl (pH 8.3), 3 mM MgCl2, 250 µg/ml bovine serum albu- min, 2% sucrose and 0.2 mM each of four deoxyribonucleotides. The products were heat-denatured and analyzed through a 5%-poly- acrylamide gel containing 6 M urea (lanes 1 and 3). Preparation of reference strands was as follows: pCSOC#5 or pY-EC16#4 DNA was used as a template for PCR with a respective set of primers (csoc-dw and csoc-up for soc, and uvsY3’ and 16S5’ for uvsY). The amplified fragments were heat-denatured and used as a template for strand elongation in the same manner as above. The reference strands were run in parallel (lanes 2 and 4). Sequence ladders obtained by dideoxynucleotide method (Innis et al., 1988) with either a combination of pCSOC#5 and csoc-up primer or a combination of pY-EC16#4 and 16S5’ primer were also run in each left four lanes (G, A, T, C) of figure A or B, respectively. In the left margins, sequences at the border of cloned DNA and vector are shown.

Article Snippet: The cDNAs were amplified by PCR containing Thermococcus kodakaraensis DNA polymerase (KOD dash, Toyobo co. ltd.) with the same primer as used for cDNA synthesis and an upstream primer.

Techniques: Infection, Amplification, Labeling, Acrylamide Gel Assay, Sequencing, Clone Assay, Plasmid Preparation

SLX1/SLX4 contribute to fragile telomere formation in Blm-deficient cells. (A) Western blot analysis of BLM in BlmF/F MEFs ± Cre (96 h). γ-Tubulin serves as the loading control. (B) Telomere FISH on metaphase spreads of BlmF/F MEFs ± Cre (96 h) with Cy3-[CCCTAA]3 probes (green) and DAPI staining (red). Fragile telomeres are marked by an asterisk. (C) Knockdown of ZRANB3, SMARCAL1, and HTLF with shRNAs (6 d) in BlmF/F MEFs verified by Western blotting. Cells infected with an shRNA targeting Luciferase (shLuc) were used as the control. γ-Tubulin serves as the loading control and an asterisk marks a nonspecific band detected by the HLTF antibody. (D) Quantification of fragile telomeres detected by FISH (q arms only) in BlmF/F MEFs ± Cre (96 h) with shRNAs targeting Luc, ZRANB3, SMARCAL1, or HTLF as described in C. (E) Quantification of q arm fragile telomeres detected by FISH in BlmF/F MEFs ± Cre (96 h) after CRISPR/Cas9 targeting of Slx4 with three different sgRNAs. Control cells were infected with an sgRNA targeting Luciferase (sgLuc). The relative level of SLX4 mRNA normalized to GAPDH was determined by RT-qPCR and compared with the sgLuc sample (set to 100). (F) Western blot analysis of SLX1 after CRISPR/Cas9 targeting of Slx1 with three different sgRNAs. γ-Tubulin serves as the loading control. (G) Quantification of q arm fragile telomeres detected by FISH in BlmF/F MEFs ± Cre (96 h) after CRISPR/Cas9 targeting of Slx1 with three different sgRNAs as in F. (H) Western blot analysis of the expression of FLAG-SLX4 and various mutants in BlmF/F MEFs with γ-Tubulin as the loading control. (I) Quantification of q arm fragile telomeres detected by FISH in BlmF/F MEFs + Cre (96 h) expressing empty vector (−), sgRNA-resistant WT FLAG-SLX4 or various mutants with CRISPR/Cas9 targeting of Luc or Slx4. (J) PLA foci (red) of TRF1 and γH2AX detected in BlmF/F MEFs ± Cre (96 h). (K) Quantification of PLA foci as in J in BlmF/F MEFs ± Cre (96 h) with CRISPR/Cas9 targeting of Luc, Slx4, or Slx1. Data are means ± SD of four independent experiments of >100 nuclei each. P-values were from paired two-tailed t-tests. (*) P ≤ 0.05. (L) PLA foci (red) of FLAG-TRF1 and 53BP1 detected in BlmF/F MEFs ± Cre (96 h). (M) Quantification of FLAG-TRF1/53BP1 PLA foci in BlmF/F MEFs ± Cre (96 h) with CRISPR/Cas9 targeting of Luc, Slx4, or Slx1. Data are means ± SD of three independent experiments of >100 nuclei each. For the fragile telomere analyses in D, E, G, and I, data are means ± SD from three independent experiments with ∼2000 telomeres analyzed per experiment. All P-values except for the ones in K were derived from unpaired two-tailed t-tests. (***) P ≤ 0.001, (**) P ≤ 0.01, (*) P ≤ 0.05, (n.s.) P > 0.05.

Journal: Genes & Development

Article Title: Break-induced replication promotes fragile telomere formation

doi: 10.1101/gad.328575.119

Figure Lengend Snippet: SLX1/SLX4 contribute to fragile telomere formation in Blm-deficient cells. (A) Western blot analysis of BLM in BlmF/F MEFs ± Cre (96 h). γ-Tubulin serves as the loading control. (B) Telomere FISH on metaphase spreads of BlmF/F MEFs ± Cre (96 h) with Cy3-[CCCTAA]3 probes (green) and DAPI staining (red). Fragile telomeres are marked by an asterisk. (C) Knockdown of ZRANB3, SMARCAL1, and HTLF with shRNAs (6 d) in BlmF/F MEFs verified by Western blotting. Cells infected with an shRNA targeting Luciferase (shLuc) were used as the control. γ-Tubulin serves as the loading control and an asterisk marks a nonspecific band detected by the HLTF antibody. (D) Quantification of fragile telomeres detected by FISH (q arms only) in BlmF/F MEFs ± Cre (96 h) with shRNAs targeting Luc, ZRANB3, SMARCAL1, or HTLF as described in C. (E) Quantification of q arm fragile telomeres detected by FISH in BlmF/F MEFs ± Cre (96 h) after CRISPR/Cas9 targeting of Slx4 with three different sgRNAs. Control cells were infected with an sgRNA targeting Luciferase (sgLuc). The relative level of SLX4 mRNA normalized to GAPDH was determined by RT-qPCR and compared with the sgLuc sample (set to 100). (F) Western blot analysis of SLX1 after CRISPR/Cas9 targeting of Slx1 with three different sgRNAs. γ-Tubulin serves as the loading control. (G) Quantification of q arm fragile telomeres detected by FISH in BlmF/F MEFs ± Cre (96 h) after CRISPR/Cas9 targeting of Slx1 with three different sgRNAs as in F. (H) Western blot analysis of the expression of FLAG-SLX4 and various mutants in BlmF/F MEFs with γ-Tubulin as the loading control. (I) Quantification of q arm fragile telomeres detected by FISH in BlmF/F MEFs + Cre (96 h) expressing empty vector (−), sgRNA-resistant WT FLAG-SLX4 or various mutants with CRISPR/Cas9 targeting of Luc or Slx4. (J) PLA foci (red) of TRF1 and γH2AX detected in BlmF/F MEFs ± Cre (96 h). (K) Quantification of PLA foci as in J in BlmF/F MEFs ± Cre (96 h) with CRISPR/Cas9 targeting of Luc, Slx4, or Slx1. Data are means ± SD of four independent experiments of >100 nuclei each. P-values were from paired two-tailed t-tests. (*) P ≤ 0.05. (L) PLA foci (red) of FLAG-TRF1 and 53BP1 detected in BlmF/F MEFs ± Cre (96 h). (M) Quantification of FLAG-TRF1/53BP1 PLA foci in BlmF/F MEFs ± Cre (96 h) with CRISPR/Cas9 targeting of Luc, Slx4, or Slx1. Data are means ± SD of three independent experiments of >100 nuclei each. For the fragile telomere analyses in D, E, G, and I, data are means ± SD from three independent experiments with ∼2000 telomeres analyzed per experiment. All P-values except for the ones in K were derived from unpaired two-tailed t-tests. (***) P ≤ 0.001, (**) P ≤ 0.01, (*) P ≤ 0.05, (n.s.) P > 0.05.

Article Snippet: Mouse Slx4 and Slx1 cDNAs were purchased from Origene and cloned into pWZL-FLAG-Hygro vector. sgRNA-resistant Slx4 (ATCTGAAACAATGCGCCGTC in place of sgRNA#2 ACTTGAAGCAGTGTGCGGTG) and Slx1 (CGGAAAAAGGGAGGTGCCTGG in place of sgRNA#1 GCAAGAAAGGTGGAGCATGG) were generated by site-directed mutagenesis using PCR.

Techniques: Western Blot, Staining, Infection, shRNA, Luciferase, CRISPR, Quantitative RT-PCR, Expressing, Plasmid Preparation, Two Tailed Test, Derivative Assay

Fragile telomeres of Blm-deficient cells arise from conservative replication. (A) Model for BIR-mediated fragile telomere formation and their removal after CO-FISH. (B) Schematic and images of CO-FISH on cells cultured in the presence of BrdU and BrdC for 16 or 26 h. The substituted DNA strands are removed by treatment with Hoechst 33258, UV, and exonuclease III. Telomeres replicated by leading-strand DNA synthesis were hybridized [TTAGGG]3 (green) and lagging-strand telomeres with [CCCTAA]3 (red). Cells labeled for 16 h (one S phase) show two signals per chromosome end, whereas cells labeled for 26 h (two S phases) show one signal per chromosome end, indicating that telomeres lacking a parental strand are poorly detected by CO-FISH. (C) Comparison of telomere FISH and CO-FISH performed on parallel metaphase spreads of BlmF/F MEFs + Cre (96 h). FISH was performed with [CCCTAA]3 (green), CO-FISH was done with [TTAGGG]3 (green) and [CCCTAA]3 (red), and DNA was stained with DAPI (blue). Fragile telomeres are marked by an asterisk. (D) Quantification of q arm fragile telomeres in BlmF/F ± Cre cells (96 h) detected by FISH and CO-FISH on the same samples derived from BrdU/BrdC-labeled cells. (E) Quantification of leading- and lagging-end q arm telomeres using CO-FISH as in D. Note that a sample with 6% lagging fragile telomeres and 2% leading fragile telomeres will show an average of 4% fragile telomeres when both sisters are scored (as is the case in D). (F) Quantification of leading- and lagging-end q arm fragile telomeres using CO-FISH in BlmF/F MEFs ± Cre (96 h) with CRISPR/Cas9 targeting of Luc, Slx4, or Slx1. (G) Quantification of leading- and lagging-end q arm fragile telomeres using CO-FISH in BlmF/F MEFs ± Cre (96 h) with shRNAs targeting Luc or Pold3. For all fragile telomere analyses in this figure, data are means ± SD of three independent experiments of ∼2000 telomeres analyzed per experiment. All P-values in this figure were derived from two-tailed unpaired t-test. (***) P ≤ 0.001, (**) P ≤ 0.01, (n.s.) P > 0.05.

Journal: Genes & Development

Article Title: Break-induced replication promotes fragile telomere formation

doi: 10.1101/gad.328575.119

Figure Lengend Snippet: Fragile telomeres of Blm-deficient cells arise from conservative replication. (A) Model for BIR-mediated fragile telomere formation and their removal after CO-FISH. (B) Schematic and images of CO-FISH on cells cultured in the presence of BrdU and BrdC for 16 or 26 h. The substituted DNA strands are removed by treatment with Hoechst 33258, UV, and exonuclease III. Telomeres replicated by leading-strand DNA synthesis were hybridized [TTAGGG]3 (green) and lagging-strand telomeres with [CCCTAA]3 (red). Cells labeled for 16 h (one S phase) show two signals per chromosome end, whereas cells labeled for 26 h (two S phases) show one signal per chromosome end, indicating that telomeres lacking a parental strand are poorly detected by CO-FISH. (C) Comparison of telomere FISH and CO-FISH performed on parallel metaphase spreads of BlmF/F MEFs + Cre (96 h). FISH was performed with [CCCTAA]3 (green), CO-FISH was done with [TTAGGG]3 (green) and [CCCTAA]3 (red), and DNA was stained with DAPI (blue). Fragile telomeres are marked by an asterisk. (D) Quantification of q arm fragile telomeres in BlmF/F ± Cre cells (96 h) detected by FISH and CO-FISH on the same samples derived from BrdU/BrdC-labeled cells. (E) Quantification of leading- and lagging-end q arm telomeres using CO-FISH as in D. Note that a sample with 6% lagging fragile telomeres and 2% leading fragile telomeres will show an average of 4% fragile telomeres when both sisters are scored (as is the case in D). (F) Quantification of leading- and lagging-end q arm fragile telomeres using CO-FISH in BlmF/F MEFs ± Cre (96 h) with CRISPR/Cas9 targeting of Luc, Slx4, or Slx1. (G) Quantification of leading- and lagging-end q arm fragile telomeres using CO-FISH in BlmF/F MEFs ± Cre (96 h) with shRNAs targeting Luc or Pold3. For all fragile telomere analyses in this figure, data are means ± SD of three independent experiments of ∼2000 telomeres analyzed per experiment. All P-values in this figure were derived from two-tailed unpaired t-test. (***) P ≤ 0.001, (**) P ≤ 0.01, (n.s.) P > 0.05.

Article Snippet: Mouse Slx4 and Slx1 cDNAs were purchased from Origene and cloned into pWZL-FLAG-Hygro vector. sgRNA-resistant Slx4 (ATCTGAAACAATGCGCCGTC in place of sgRNA#2 ACTTGAAGCAGTGTGCGGTG) and Slx1 (CGGAAAAAGGGAGGTGCCTGG in place of sgRNA#1 GCAAGAAAGGTGGAGCATGG) were generated by site-directed mutagenesis using PCR.

Techniques: Cell Culture, DNA Synthesis, Labeling, Comparison, Staining, Derivative Assay, CRISPR, Two Tailed Test

Primers used in this study

Journal: Annals of Translational Medicine

Article Title: Upregulation of long noncoding RNA RAB11B-AS1 promotes tumor metastasis and predicts poor prognosis in lung cancer

doi: 10.21037/atm.2020.04.52

Figure Lengend Snippet: Primers used in this study

Article Snippet: Plasmids, cell transfection and stable cell lines The full-length complimentary DNA of human lnc - RAB11B - AS1 and small hairpin RNA (shRNA) targeting lnc - RAB11B - AS1 were both synthesized by GeneCopoeia (MD, USA).

Techniques:

Expression pattern of lnc-RAB11B-AS1 and its association with lung cancer survival. (A) Expression pattern of lnc-RAB11B-AS1 in lung cancer tissues. The expression level of lnc-RAB11B-AS1 was significantly higher in lung cancerous tissues compared with adjacent normal lung tissues. Results are shown as Log (tumor/normal). P was calculated by the paired t-test. (B) Effect of lnc-RAB11B-AS1 expression on lung cancer survival. Patients with high expression of lnc-RAB11B-AS1 showed a significantly poorer survival than those with low expression of lnc-RAB11B-AS1. P was calculated by the log-rank test. (C) Relative expression of lnc-RAB11B-AS1 in nine lung cancer cell lines and three normal pulmonary epithelial cell lines. (D) Expression of lnc-RAB11B-AS1 in nuclear and cytoplasmic fractions of LC cells. (E) Expression of RAB11B protein in lung cancer tissues.

Journal: Annals of Translational Medicine

Article Title: Upregulation of long noncoding RNA RAB11B-AS1 promotes tumor metastasis and predicts poor prognosis in lung cancer

doi: 10.21037/atm.2020.04.52

Figure Lengend Snippet: Expression pattern of lnc-RAB11B-AS1 and its association with lung cancer survival. (A) Expression pattern of lnc-RAB11B-AS1 in lung cancer tissues. The expression level of lnc-RAB11B-AS1 was significantly higher in lung cancerous tissues compared with adjacent normal lung tissues. Results are shown as Log (tumor/normal). P was calculated by the paired t-test. (B) Effect of lnc-RAB11B-AS1 expression on lung cancer survival. Patients with high expression of lnc-RAB11B-AS1 showed a significantly poorer survival than those with low expression of lnc-RAB11B-AS1. P was calculated by the log-rank test. (C) Relative expression of lnc-RAB11B-AS1 in nine lung cancer cell lines and three normal pulmonary epithelial cell lines. (D) Expression of lnc-RAB11B-AS1 in nuclear and cytoplasmic fractions of LC cells. (E) Expression of RAB11B protein in lung cancer tissues.

Article Snippet: Plasmids, cell transfection and stable cell lines The full-length complimentary DNA of human lnc - RAB11B - AS1 and small hairpin RNA (shRNA) targeting lnc - RAB11B - AS1 were both synthesized by GeneCopoeia (MD, USA).

Techniques: Expressing

Association between the expression level of  lnc-RAB11B-AS1  and the clinic characteristics of the patients

Journal: Annals of Translational Medicine

Article Title: Upregulation of long noncoding RNA RAB11B-AS1 promotes tumor metastasis and predicts poor prognosis in lung cancer

doi: 10.21037/atm.2020.04.52

Figure Lengend Snippet: Association between the expression level of lnc-RAB11B-AS1 and the clinic characteristics of the patients

Article Snippet: Plasmids, cell transfection and stable cell lines The full-length complimentary DNA of human lnc - RAB11B - AS1 and small hairpin RNA (shRNA) targeting lnc - RAB11B - AS1 were both synthesized by GeneCopoeia (MD, USA).

Techniques: Expressing

COX model of the significant variables

Journal: Annals of Translational Medicine

Article Title: Upregulation of long noncoding RNA RAB11B-AS1 promotes tumor metastasis and predicts poor prognosis in lung cancer

doi: 10.21037/atm.2020.04.52

Figure Lengend Snippet: COX model of the significant variables

Article Snippet: Plasmids, cell transfection and stable cell lines The full-length complimentary DNA of human lnc - RAB11B - AS1 and small hairpin RNA (shRNA) targeting lnc - RAB11B - AS1 were both synthesized by GeneCopoeia (MD, USA).

Techniques:

Association between the expression level of  lnc-RAB11B-AS1  and the prognosis of the lung cancer patients

Journal: Annals of Translational Medicine

Article Title: Upregulation of long noncoding RNA RAB11B-AS1 promotes tumor metastasis and predicts poor prognosis in lung cancer

doi: 10.21037/atm.2020.04.52

Figure Lengend Snippet: Association between the expression level of lnc-RAB11B-AS1 and the prognosis of the lung cancer patients

Article Snippet: Plasmids, cell transfection and stable cell lines The full-length complimentary DNA of human lnc - RAB11B - AS1 and small hairpin RNA (shRNA) targeting lnc - RAB11B - AS1 were both synthesized by GeneCopoeia (MD, USA).

Techniques: Expressing

Lnc-RAB11B-AS1 promotes cancer cell proliferation, apoptosis, colony formation and cell cycle progression in LC cells in vitro. (A) Lnc-RAB11B-AS1 over-expression significantly enhanced lung cancer cell viability, while silencing of lnc-RAB11B-AS1 reduced cell viability of both A549 and PC-9 cell lines; (B) over-expression of lnc-RAB11B-AS1 decreased the numbers of G1 phase cells and increased the numbers of cells in M phase, while silencing of lnc-RAB11B-AS1 had the opposite effects; (C) Lnc-RAB11B-AS1 over-expression caused a decrease in apoptosis and silencing increased the apoptosis rate in both A549 and PC-9 cell lines; (D) the tablet clone formation efficiency of the transformed cell lines showed significant increases in lnc-RAB11B-AS1 overexpressed cell lines and decreases in lnc-RAB11B-AS1 silenced cell lines. *, P value <0.05; **, P value <0.01.

Journal: Annals of Translational Medicine

Article Title: Upregulation of long noncoding RNA RAB11B-AS1 promotes tumor metastasis and predicts poor prognosis in lung cancer

doi: 10.21037/atm.2020.04.52

Figure Lengend Snippet: Lnc-RAB11B-AS1 promotes cancer cell proliferation, apoptosis, colony formation and cell cycle progression in LC cells in vitro. (A) Lnc-RAB11B-AS1 over-expression significantly enhanced lung cancer cell viability, while silencing of lnc-RAB11B-AS1 reduced cell viability of both A549 and PC-9 cell lines; (B) over-expression of lnc-RAB11B-AS1 decreased the numbers of G1 phase cells and increased the numbers of cells in M phase, while silencing of lnc-RAB11B-AS1 had the opposite effects; (C) Lnc-RAB11B-AS1 over-expression caused a decrease in apoptosis and silencing increased the apoptosis rate in both A549 and PC-9 cell lines; (D) the tablet clone formation efficiency of the transformed cell lines showed significant increases in lnc-RAB11B-AS1 overexpressed cell lines and decreases in lnc-RAB11B-AS1 silenced cell lines. *, P value <0.05; **, P value <0.01.

Article Snippet: Plasmids, cell transfection and stable cell lines The full-length complimentary DNA of human lnc - RAB11B - AS1 and small hairpin RNA (shRNA) targeting lnc - RAB11B - AS1 were both synthesized by GeneCopoeia (MD, USA).

Techniques: In Vitro, Over Expression, Transformation Assay

Lnc-RAB11B-AS1 promotes cancer cell migration and invasion activities in LC cells in vitro and enhances tumor growth in vivo. (A,B) Cell lines with overexpressed lnc-RAB11B-AS1 showed significantly higher migration and invasion activities compared with controls, while cell lines silenced for lnc-RAB11B-AS1 exerted significantly lower abilities; (C,D) tumor growth was increased in xenograft mice implanted with stable transfected in lnc-RAB11B-AS1 overexpressed cells and attenuated in xenograft mice implanted with lnc-RAB11B-AS1 silenced cells compared with controls. All results are shown as mean ± SD. P<0.05, calculated by the one-way ANOVA test. *, P value <0.05; **, P value <0.01.

Journal: Annals of Translational Medicine

Article Title: Upregulation of long noncoding RNA RAB11B-AS1 promotes tumor metastasis and predicts poor prognosis in lung cancer

doi: 10.21037/atm.2020.04.52

Figure Lengend Snippet: Lnc-RAB11B-AS1 promotes cancer cell migration and invasion activities in LC cells in vitro and enhances tumor growth in vivo. (A,B) Cell lines with overexpressed lnc-RAB11B-AS1 showed significantly higher migration and invasion activities compared with controls, while cell lines silenced for lnc-RAB11B-AS1 exerted significantly lower abilities; (C,D) tumor growth was increased in xenograft mice implanted with stable transfected in lnc-RAB11B-AS1 overexpressed cells and attenuated in xenograft mice implanted with lnc-RAB11B-AS1 silenced cells compared with controls. All results are shown as mean ± SD. P<0.05, calculated by the one-way ANOVA test. *, P value <0.05; **, P value <0.01.

Article Snippet: Plasmids, cell transfection and stable cell lines The full-length complimentary DNA of human lnc - RAB11B - AS1 and small hairpin RNA (shRNA) targeting lnc - RAB11B - AS1 were both synthesized by GeneCopoeia (MD, USA).

Techniques: Migration, In Vitro, In Vivo, Transfection

Correlation between lnc-RAB11B-AS1 and RAB11B expression. (A) The relative position of lnc-RAB11B-AS1 and RAB11B in human genome; (B) relative expression level of RAB11B in LC patients (N=276). P<0.01; (C) correlation between lnc-RAB11B-AS1 and RAB11B; (D) high expression of lnc-RAB11B-AS1 resulted in high RAB11B expression, while low expression of lnc-RAB11B-AS1 caused low RAB11B expression in stably transfected A549 and PC-9 cell lines; (E) upregulation of lnc-RAB11B-AS1 induced a significant increase in the luciferase activity of pGL3-Promoter-RAB11B in LC cell lines; (F) relative expression of RAB11B was measured by qPCR in A549 and PC-9 cells stably silenced for lnc-RAB11B-AS1 and transfected with si-RAB11B or si-CTRL; (G,H) CCK-8 assays were conducted to detect the effect of si-RAB11B on stably overexpression lnc-RAB11B-AS1 cell lines. *, P value <0.05; **, P value <0.01.

Journal: Annals of Translational Medicine

Article Title: Upregulation of long noncoding RNA RAB11B-AS1 promotes tumor metastasis and predicts poor prognosis in lung cancer

doi: 10.21037/atm.2020.04.52

Figure Lengend Snippet: Correlation between lnc-RAB11B-AS1 and RAB11B expression. (A) The relative position of lnc-RAB11B-AS1 and RAB11B in human genome; (B) relative expression level of RAB11B in LC patients (N=276). P<0.01; (C) correlation between lnc-RAB11B-AS1 and RAB11B; (D) high expression of lnc-RAB11B-AS1 resulted in high RAB11B expression, while low expression of lnc-RAB11B-AS1 caused low RAB11B expression in stably transfected A549 and PC-9 cell lines; (E) upregulation of lnc-RAB11B-AS1 induced a significant increase in the luciferase activity of pGL3-Promoter-RAB11B in LC cell lines; (F) relative expression of RAB11B was measured by qPCR in A549 and PC-9 cells stably silenced for lnc-RAB11B-AS1 and transfected with si-RAB11B or si-CTRL; (G,H) CCK-8 assays were conducted to detect the effect of si-RAB11B on stably overexpression lnc-RAB11B-AS1 cell lines. *, P value <0.05; **, P value <0.01.

Article Snippet: Plasmids, cell transfection and stable cell lines The full-length complimentary DNA of human lnc - RAB11B - AS1 and small hairpin RNA (shRNA) targeting lnc - RAB11B - AS1 were both synthesized by GeneCopoeia (MD, USA).

Techniques: Expressing, Stable Transfection, Transfection, Luciferase, Activity Assay, CCK-8 Assay, Over Expression

Association between the expression level of  RAB11B  and the clinic characteristics of the patients

Journal: Annals of Translational Medicine

Article Title: Upregulation of long noncoding RNA RAB11B-AS1 promotes tumor metastasis and predicts poor prognosis in lung cancer

doi: 10.21037/atm.2020.04.52

Figure Lengend Snippet: Association between the expression level of RAB11B and the clinic characteristics of the patients

Article Snippet: Plasmids, cell transfection and stable cell lines The full-length complimentary DNA of human lnc - RAB11B - AS1 and small hairpin RNA (shRNA) targeting lnc - RAB11B - AS1 were both synthesized by GeneCopoeia (MD, USA).

Techniques: Expressing

Expression of the TdIF1 gene in lung cancer. a The RNA-Seq data of 57 pairs of cancer and adjacent nontumor tissues from lung cancer patients were obtained from the TCGA common database and analyzed by Cuffdiff2. The fold changes in TdIF1 expression in lung cancer tissue vs noncancerous adjacent tissue were calculated and displayed. b Kaplan–Meier analysis of overall survival of patients with expression of TdIF1 in 82 lung adenocarcinoma patients (* P = 0.037). c H&E and immunohistochemical staining to detect TdIF1 expression in lung cancer and noncancer adjacent tissue. d Transcript abundance of TdIF1 in lung cancer cell lines. Expression of TdIF1 in 3 lung cancer cell lines. The three indicated lung cancer cell lines were cultured, and mRNA was collected. The expression of TdIF1 was determined by quantitative PCR. The abundance of TdIF1 expression was calculated in comparison to the internal control housekeeping gene, GAPDH. e Expression of TdIF1 in normal lung cell lines. Total protein (40 μg) was extracted from the normal human lung cell line BEAS-2B (bronchial epithelial cells) and the lung cancer cell line A549. Samples were subjected to western blotting using antibodies against TdIF1 and GAPDH. The data show one of three representative experiments. Error bars represent the standard deviation of three experiments

Journal: Signal Transduction and Targeted Therapy

Article Title: TdIF1: a putative oncogene in NSCLC tumor progression

doi: 10.1038/s41392-018-0030-9

Figure Lengend Snippet: Expression of the TdIF1 gene in lung cancer. a The RNA-Seq data of 57 pairs of cancer and adjacent nontumor tissues from lung cancer patients were obtained from the TCGA common database and analyzed by Cuffdiff2. The fold changes in TdIF1 expression in lung cancer tissue vs noncancerous adjacent tissue were calculated and displayed. b Kaplan–Meier analysis of overall survival of patients with expression of TdIF1 in 82 lung adenocarcinoma patients (* P = 0.037). c H&E and immunohistochemical staining to detect TdIF1 expression in lung cancer and noncancer adjacent tissue. d Transcript abundance of TdIF1 in lung cancer cell lines. Expression of TdIF1 in 3 lung cancer cell lines. The three indicated lung cancer cell lines were cultured, and mRNA was collected. The expression of TdIF1 was determined by quantitative PCR. The abundance of TdIF1 expression was calculated in comparison to the internal control housekeeping gene, GAPDH. e Expression of TdIF1 in normal lung cell lines. Total protein (40 μg) was extracted from the normal human lung cell line BEAS-2B (bronchial epithelial cells) and the lung cancer cell line A549. Samples were subjected to western blotting using antibodies against TdIF1 and GAPDH. The data show one of three representative experiments. Error bars represent the standard deviation of three experiments

Article Snippet: The human lung adenocarcinoma cell lines A549, H1299, and H1975 and the normal human lung bronchial epithelial cell line BEAS-2B were obtained from the American Type Culture Collection (ATCC) and cultured in DMEM (Invitrogen Life Technologies, Carlsbad, CA, USA) with 10% FBS and standard amounts of l -glutamine, penicillin, and streptomycin at 37 °C in 5% CO 2 .

Techniques: Expressing, RNA Sequencing, Immunohistochemical staining, Staining, Cell Culture, Real-time Polymerase Chain Reaction, Comparison, Control, Western Blot, Standard Deviation

Suppression of tumor cell growth after shRNA-mediated gene knockdown of TdIF1 in A549 cells. a Knockdown of TdIF1 in A549 lung cancer cells via TdIF1-shRNA lentiviral vector. The lentiviral vector is a hU6-MCS-CMV-EGFP construct. The RNA sequence (TTCTCCGAACGTGTCACGT) was synthesized and ligated into the lentiviral vector. A549 cells were cultured and transfected with the TdIF1 shRNA lentiviral vector (shTdIF1) or a control nonspecific shRNA vector (shCtrl) at an MOI of 10 for 24 h. TdIF1 mRNA was detected by qPCR, and TdIF1 protein expression was detected by western blot. b In vitro suppression of cell proliferation by gene silencing of TdIF1. A549 cells were transfected with the lentiviral vector shTdIF1 or the control vector shCtrl at an MOI of 10 for 24 h. Live cells were stained with a green dye and detected by a Celigo image cytometer for 5 days. Cell images, cell number counts and cell proliferation fold changes are presented. c Decreased colony formation of A549 cells after gene knockdown of TdIF1. A549 cells were transfected with the lentiviral vector shTdIF1 or the control vector shCtrl at an MOI of 1:100 for 24 h. Approximately 1000 cells were plated in 6-well plates and cultured for 11 days. The cell clones were determined by staining with crystal violet. The crystal violet-stained colonies were imaged and counted (presented as a percentage) using a microscope. Error bars represent the standard deviation of three experiments (* P < 0.05; ** P < 0.01)

Journal: Signal Transduction and Targeted Therapy

Article Title: TdIF1: a putative oncogene in NSCLC tumor progression

doi: 10.1038/s41392-018-0030-9

Figure Lengend Snippet: Suppression of tumor cell growth after shRNA-mediated gene knockdown of TdIF1 in A549 cells. a Knockdown of TdIF1 in A549 lung cancer cells via TdIF1-shRNA lentiviral vector. The lentiviral vector is a hU6-MCS-CMV-EGFP construct. The RNA sequence (TTCTCCGAACGTGTCACGT) was synthesized and ligated into the lentiviral vector. A549 cells were cultured and transfected with the TdIF1 shRNA lentiviral vector (shTdIF1) or a control nonspecific shRNA vector (shCtrl) at an MOI of 10 for 24 h. TdIF1 mRNA was detected by qPCR, and TdIF1 protein expression was detected by western blot. b In vitro suppression of cell proliferation by gene silencing of TdIF1. A549 cells were transfected with the lentiviral vector shTdIF1 or the control vector shCtrl at an MOI of 10 for 24 h. Live cells were stained with a green dye and detected by a Celigo image cytometer for 5 days. Cell images, cell number counts and cell proliferation fold changes are presented. c Decreased colony formation of A549 cells after gene knockdown of TdIF1. A549 cells were transfected with the lentiviral vector shTdIF1 or the control vector shCtrl at an MOI of 1:100 for 24 h. Approximately 1000 cells were plated in 6-well plates and cultured for 11 days. The cell clones were determined by staining with crystal violet. The crystal violet-stained colonies were imaged and counted (presented as a percentage) using a microscope. Error bars represent the standard deviation of three experiments (* P < 0.05; ** P < 0.01)

Article Snippet: The human lung adenocarcinoma cell lines A549, H1299, and H1975 and the normal human lung bronchial epithelial cell line BEAS-2B were obtained from the American Type Culture Collection (ATCC) and cultured in DMEM (Invitrogen Life Technologies, Carlsbad, CA, USA) with 10% FBS and standard amounts of l -glutamine, penicillin, and streptomycin at 37 °C in 5% CO 2 .

Techniques: shRNA, Knockdown, Plasmid Preparation, Construct, Sequencing, Synthesized, Cell Culture, Transfection, Control, Expressing, Western Blot, In Vitro, Staining, Cytometry, Clone Assay, Microscopy, Standard Deviation

Effect of TdIF1 knockdown on tumor profiles in a xenograft NSCLC model established in nude mice. a Suppression of tumor cell growth after gene knockdown of TdIF1 in A549 cells. A549 cells were transfected with shTdIF1 (KD) and control shCtrl (NC) vectors. Twenty-four hours after gene transfection, 5 × 10 5 cells were inoculated into immune-deficient nude mice. Tumor growth was measured on the indicated days and was estimated using the following formula: tumor volume = 0.5 × length × width. b Tumor weights were measured at the endpoint of experiments. Tumor weight was decreased between WT (NC) and TdIF1-KD mice. c Tumor size. The tumor size at the end of the experiments was photographed along with the animals, indicating a distinct decrease in tumor size with no significant differences in endpoint animal size. Error bars represent the standard deviation of 10 experimental or control mice (*** P < 0.001)

Journal: Signal Transduction and Targeted Therapy

Article Title: TdIF1: a putative oncogene in NSCLC tumor progression

doi: 10.1038/s41392-018-0030-9

Figure Lengend Snippet: Effect of TdIF1 knockdown on tumor profiles in a xenograft NSCLC model established in nude mice. a Suppression of tumor cell growth after gene knockdown of TdIF1 in A549 cells. A549 cells were transfected with shTdIF1 (KD) and control shCtrl (NC) vectors. Twenty-four hours after gene transfection, 5 × 10 5 cells were inoculated into immune-deficient nude mice. Tumor growth was measured on the indicated days and was estimated using the following formula: tumor volume = 0.5 × length × width. b Tumor weights were measured at the endpoint of experiments. Tumor weight was decreased between WT (NC) and TdIF1-KD mice. c Tumor size. The tumor size at the end of the experiments was photographed along with the animals, indicating a distinct decrease in tumor size with no significant differences in endpoint animal size. Error bars represent the standard deviation of 10 experimental or control mice (*** P < 0.001)

Article Snippet: The human lung adenocarcinoma cell lines A549, H1299, and H1975 and the normal human lung bronchial epithelial cell line BEAS-2B were obtained from the American Type Culture Collection (ATCC) and cultured in DMEM (Invitrogen Life Technologies, Carlsbad, CA, USA) with 10% FBS and standard amounts of l -glutamine, penicillin, and streptomycin at 37 °C in 5% CO 2 .

Techniques: Knockdown, Transfection, Control, Standard Deviation

TdIF1 gene interaction pathway. a Hierarchical clustering of differential gene expression in A549 cells transfected with shTdIF1 (KD samples 213–2, 213–3 and 213–1) vs. control shCtrl (NC: 214–2, 214–1, and 214–3) vector. In the heat map, columns represent samples, and rows represent genes. The upper dendritic structure is the aggregation or classification of all samples according to the expression profile of different genes, while the left dendritic structure indicates the expression pattern aggregation of different genes. Red represents relatively high gene expression, green represents relatively low gene expression, black indicates no significant change in gene expression, and gray indicates undetected genes. Fold change >1.5 and FDR<0.05 were used as standards for screening. b The top 15 significant pathways of differential gene expression in A549 cells transfected with shTdIF1 vs. control shCtrl vector using Pathway Enrichment Analysis. The X -axis is the name of the pathway, and the Y -axis is the significance level of enrichment (negative logarithmic transformation at the base of 10). Among these, orange represents activated pathways ( Z -score > 0), blue represents suppressed pathways ( Z -score < 0), and the gradation of orange and blue represents the degree of activation or suppression (in accordance with the internal algorithm and IPA standard that a Z -score > 2 for a pathway represents significantly activated, while a Z -score < -2 for a pathway represents significantly suppressed); the ratio represents the number of differentially expressed genes in this signaling pathway to the number of all genes contained in this pathway. c In silico analysis of the TdIF1 gene interaction network. The protein interaction network map was built using the Ingenuity Pathway Analysis software (Qiagen) to determine the putative interactions of interest (blue circles) with TdIF1 (red circle). d Gene expression after gene silencing of TdIF1. The lung cancer cell line A549 was cultured and transfected with TdIF1 shRNA lentiviral vector (KD) or control nonspecific siRNA vector (NC) at an MOI of 10 for 24 h. Total RNA was collected from the cells after gene silencing, and the expression of HDAC1 and HDAC2 was detected by qPCR. e p53 and acetyl-p53 expression levels in TdIF1 knockdown A549 cells. A549 cells were transfected with siTdIF1 (KD) or control nonspecific siRNA vector (NC) for 72 h, followed by immunoblotting analysis using the indicated antibodies. f Expression of cell cycle-related genes after gene silencing of TdIF1. The A549 cells were transfected with siTdIF1 or control nonspecific siRNA vector (NC) for 48 h. The expression of CDK4, cyclin D1, CDK6, CDC20 and CDC25C was detected by quantitative RT–PCR. Error bars represent the standard deviation of three experiments (* P < 0.05)

Journal: Signal Transduction and Targeted Therapy

Article Title: TdIF1: a putative oncogene in NSCLC tumor progression

doi: 10.1038/s41392-018-0030-9

Figure Lengend Snippet: TdIF1 gene interaction pathway. a Hierarchical clustering of differential gene expression in A549 cells transfected with shTdIF1 (KD samples 213–2, 213–3 and 213–1) vs. control shCtrl (NC: 214–2, 214–1, and 214–3) vector. In the heat map, columns represent samples, and rows represent genes. The upper dendritic structure is the aggregation or classification of all samples according to the expression profile of different genes, while the left dendritic structure indicates the expression pattern aggregation of different genes. Red represents relatively high gene expression, green represents relatively low gene expression, black indicates no significant change in gene expression, and gray indicates undetected genes. Fold change >1.5 and FDR<0.05 were used as standards for screening. b The top 15 significant pathways of differential gene expression in A549 cells transfected with shTdIF1 vs. control shCtrl vector using Pathway Enrichment Analysis. The X -axis is the name of the pathway, and the Y -axis is the significance level of enrichment (negative logarithmic transformation at the base of 10). Among these, orange represents activated pathways ( Z -score > 0), blue represents suppressed pathways ( Z -score < 0), and the gradation of orange and blue represents the degree of activation or suppression (in accordance with the internal algorithm and IPA standard that a Z -score > 2 for a pathway represents significantly activated, while a Z -score < -2 for a pathway represents significantly suppressed); the ratio represents the number of differentially expressed genes in this signaling pathway to the number of all genes contained in this pathway. c In silico analysis of the TdIF1 gene interaction network. The protein interaction network map was built using the Ingenuity Pathway Analysis software (Qiagen) to determine the putative interactions of interest (blue circles) with TdIF1 (red circle). d Gene expression after gene silencing of TdIF1. The lung cancer cell line A549 was cultured and transfected with TdIF1 shRNA lentiviral vector (KD) or control nonspecific siRNA vector (NC) at an MOI of 10 for 24 h. Total RNA was collected from the cells after gene silencing, and the expression of HDAC1 and HDAC2 was detected by qPCR. e p53 and acetyl-p53 expression levels in TdIF1 knockdown A549 cells. A549 cells were transfected with siTdIF1 (KD) or control nonspecific siRNA vector (NC) for 72 h, followed by immunoblotting analysis using the indicated antibodies. f Expression of cell cycle-related genes after gene silencing of TdIF1. The A549 cells were transfected with siTdIF1 or control nonspecific siRNA vector (NC) for 48 h. The expression of CDK4, cyclin D1, CDK6, CDC20 and CDC25C was detected by quantitative RT–PCR. Error bars represent the standard deviation of three experiments (* P < 0.05)

Article Snippet: The human lung adenocarcinoma cell lines A549, H1299, and H1975 and the normal human lung bronchial epithelial cell line BEAS-2B were obtained from the American Type Culture Collection (ATCC) and cultured in DMEM (Invitrogen Life Technologies, Carlsbad, CA, USA) with 10% FBS and standard amounts of l -glutamine, penicillin, and streptomycin at 37 °C in 5% CO 2 .

Techniques: Gene Expression, Transfection, Control, Plasmid Preparation, Expressing, Transformation Assay, Activation Assay, In Silico, Software, Cell Culture, shRNA, Knockdown, Western Blot, Quantitative RT-PCR, Standard Deviation